Instrument: Illumina HiSeq 2500
Strategy: OTHER
Source: TRANSCRIPTOMIC
Selection: other
Layout: PAIRED
Construction protocol: A minimum of 400,000 GFP-positive, sorted cells were used to isolate total RNA using Trizol (Thermo Fisher) according to manufacturer's instructions. The mRNA fraction was captured using Oligo (dT)25 beads (61002, Life Technologies) and DNAseI treated (18068-015, Life Technologies), followed by reverse transcription using 2 ul SuperscriptIII (18080-044, Life Technologies) using a GFP-mRNA specific primer (149 STARRseq rep RNA cDNA synth, CAAACTCATCAATGTATCTTATCATG) at 50ᴼC for 90 minutes, in a total reaction volume of 21 ul. To repress residual plasmid DNA contamination, cDNA was PCR amplified using a combination of primers (152 STARR reporter specific primer 2 fw, GGGCCAGCTGTTGGGGTG*T*C*C*A*C and 153 STARR reporter specific primer 2 rv, CTTATCATGTCTGCTCGA*A*G*C, where * represent phosphorothioate bonds) spanning a synthetic intron in the STARR-seq plasmid, as previously described (Arnold et al., 2013). PCR was performed with Phusion polymerase and High-fidelity buffer, in 6 x 50 ul reactions (cycling conditions: 98ᴼC 2 min, (98ᴼC 10 sec, 62ᴼC 30 sec, 72ᴼC 70 sec) x15, 72ᴼC 5 min, 4ᴼC hold). PCR reactions were pooled, purified using AMPureXP beads (1.0x) and eluted in 18 ul 0.1xTE. Absence of significant plasmid contamination in the PCR amplified cDNA was assessed by qPCR using a primer-set amplifying an amplicon from the STARR-seq plasmid backbone (161 STARRseq detect plasmid backbone qPCR fw, CATCATCGGGAATCGTTCTT, and 162 STARRSeq detect plasmid backbone qPCR rv, TGAAGATCAACTGGGTGCAA), relative to a primer-set amplifying GFP (154 STARRseq GFP fw, ACGGCCACAAGTTCTCTGTC, and 155 STARRseq GFP rv, GCAGTTTGCCAGTAGTGCAG). PCR amplified cDNA was then used in a second round of PCR to add Illumina index primers (7335, 7500, NEB) using priming on the adapter sequences added during the plasmid library generation. PCR was performed in 1-4x 50 ul reactions using Phusion polymerase and High-fidelity buffer (NEB)(cycling conditions: 98ᴼC 2 min, (98ᴼC 10 sec, 65ᴼC 30 sec, 72ᴼC 30 sec) x13, 72ᴼC 5 min, 4ᴼC hold), after which PCR reactions were pooled, purified using AMPureXP beads (1.0x) and eluted in 15 ul 0.1xTE. Quantity and quality of generated sequencing libraries was assessed on an Agilent Tapestation.